rs10853728 chr19:39254506 C>G
- Sequence
gtaagcagcctgggagatgtgggc[C/G]taagctttggtgaggatgagagtc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MEIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | -1.79 | 2.73 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-hepatitis c virus treatment response (null virologic responder to pegylated interferon-alpha and ribavarin therapy), hepatitis c infection (chronic versus spontaneously resolved), microalbuminuria, response to chronic hepatitis c interferon-alpha and ribavirin therapy, response to type i interferon treatment of chronic hepatitis c virus infection