rs10854193 chr20:53711799 G>A
- Sequence
gagggcgtctgcagccagtgtggc[G/A]agccacatcctcgagttgtttggg
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.23 | 0.66 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, premature ovarian failure, prostate cancer, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females)