rs10854430 chr21:19046073 C>T
- Sequence
aggcaatgacattgctggtttcca[C/T]agcaaccaaatcctgagtattctt
- ASB in cell types
- neural cell K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.08 | 1.44 | 1.00 | |||
| K562 (myelogenous leukemia) | n/a | 2.50 | 3.00 |
Items per page:
1 – 2 of 2