rs10859402 chr12:93016067 G>A
- Sequence
cgccccaccatgaagctgaggcac[G/A]aatggcagtgatgctattgttttg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.30 | -0.49 | 3.00 |
Items per page:
1 – 1 of 1