rs10859504 chr12:93525506 G>A
- Sequence
ccatcaataaaatttgtttcccac[G/A]tggaaatgcacaaccatggggcat
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) OCI-LY7 (diffuse large B-cell lymphoma) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.48 | 1.17 | 1.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 2.17 | -2.16 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.13 | -0.57 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood