rs10859513 chr12:93530500 T>G
- Sequence
tatgggaacttactttcaaaacca[T/G]ttcctccttcatttatcagttaac
- ASB in cell types
- primary endothelial colony-forming cells CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- TAL1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 2.43 | -3.92 | 1.50 | n/a | No Hit | |||
| SPI1_HUMAN | 0.05 | 1.26 | 1.22 | 3.08 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), gene expression, hdl cholesterol change with statins, height, ldl cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg