rs10860819 chr12:101917924 A>C
- Sequence
ctttacttttcagccactcggggg[A/C]gaccttctatcacaaacccgctgc
- ASB in cell types
- GBM39 (Human brain tumor) HT1080 (fibrosarcoma) prostate gland T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GBM39 (Human brain tumor) | 0.73 | 3.13 | 1.00 | |||
| HT1080 (fibrosarcoma) | 1.33 | 2.64 | 1.00 | |||
| prostate gland | 1.98 | -1.74 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.15 | 1.09 | 1.11 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood