rs10861492 chr12:105726750 C>T
- Sequence
cttttttattgttaaggagtgtcc[C/T]tttatatgtatatacagtcagccc
- ASB in cell types
- LNCaP C4-2 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2 (prostate carcinoma) | -3.29 | 2.04 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, waist hip ratio