rs10862770 chr12:83824115 G>C
- Sequence
ctttctgtgtggcagggtctggag[G/C]ttttatgggctcagaattggaagt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.34 | 1.80 | 1.44 | n/a | No Hit | |||
| STAG1_HUMAN | 0.27 | 1.78 | 1.14 | n/a | n/a |
Items per page:
1 – 2 of 2