rs10863319 chr1:217334108 C>A
- Sequence
tctgctcccaacctagggcataga[C/A]cccaccagggaggctggagctccc
- ASB in cell types
- WA09 (embryonic stem cells) RH4 (alveolar rhabdomyosarcoma) foreskin keratinocyte Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.76 | -0.41 | 1.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | -2.68 | 1.61 | 1.50 | |||
| foreskin keratinocyte | 0.73 | n/a | 2.17 | |||
| Peyer's patch | -2.22 | 2.19 | 1.00 | |||
| liver | -1.54 | 2.12 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol change with statins