rs10863914 chr1:211515384 G>T
- Sequence
ccctccccttcgacgtctccaccc[G/T]gtatggaacattaatcattaaccg
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) 2588 (Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.45 | 0.92 | 1.96 | |||
| HCT-116 (colon carcinoma) | 0.71 | 1.22 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 2.08 | -0.32 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 0.89 | -0.04 | 1.00 | |||
| HeLa-LTR-Luciferase cells | -0.56 | 1.99 | 1.00 |
Items per page:
1 – 5 of 5