rs10864654 chr1:231020283 A>G
- Sequence
ggatgctttggatttccagttttg[A/G]gaacaccttaattgtgttatgccc
- ASB in cell types
- spleen
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | 2.70 | -2.57 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), late onset alzheimers disease, systolic blood pressure (sbp), total cholesterol change with statins
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cortex, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood