rs10864690 chr1:230101793 T>A
- Sequence
tgagaattgccctctctttcatca[T/A]gaaacgtataagatggcctcctcc
- ASB in cell types
- embryonic kidney
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.64 | 0.68 | 2.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), coronary artery disease (cad), hdl cholesterol, irritible bowel syndrome, simpson-angus scale, total cholesterol, triglycerides, type 2 diabetes, combined control dataset