rs10867519 chr9:80387703 T>G
- Sequence
gttggctacatagattaggtaaac[T/G]catcttgtttaatcataaaacaaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- HXB13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HXB13_HUMAN | 2.29 | -1.84 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting blood glucose, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins