rs10868235 chr9:84878840 C>T
- Sequence
ttctggcctggatcttgtgtaaac[C/T]tctggcctttgcaaagctgttatg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.05 | 2.52 | 1.87 | 0.38 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), irritible bowel syndrome, rheumatoid arthritis, suicidal ideation with anti-depressant treatment, suicidal ideation with escitalopram treatment, suicide attempts in major depressive disorder