rs10868764 chr9:88378687 A>T
- Sequence
tccagaggctaatgaataatgata[A/T]ctgctgaaccagggaatggaaggg
- ASB in cell types
- HUES8 (Embryonic stem cell, blastocyst stage)
- ASB for transcription factors
- NANOG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NANOG_HUMAN | 1.74 | -1.22 | 1.00 | 0.34 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Whole_Blood