rs10869066 chr9:71819321 G>A
- Sequence
tgagaagaaaagcagcatcttctg[G/A]gcgcccccttgtggcttggattaa
- ASB in cell types
- HMEC (human mammary epithelial cells) CD34+ stem cells-derived erythroblasts spleen esophagus muscularis mucosa
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.66 | 1.04 | 1.22 | 0.45 | Weak Concordant | |||
| STAG1_HUMAN | 0.13 | 1.24 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
