rs10869574 chr9:68949508 A>G
- Sequence
ggactctctgaagaaattaagagg[A/G]cataacatgtaatgccagaaatat
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.18 | -0.85 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -0.35 | 1.22 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, chronic kidney disease, diastolic blood pressure (dbp), height, infant head circumference, serum creatinine, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Nerve_Tibial