rs10870304 chr10:132418561 G>A
- Sequence
aatcacccagaatcacttcctccc[G/A]gaggggctgggctcatcctcctga
- ASB in cell types
- monocyte-derived macrophages from peripheral blood LNCaP C4-2 (prostate carcinoma)
- ASB for transcription factors
- SPI1_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.41 | 2.52 | 2.00 | 0.98 | Weak Concordant | |||
| BRD4_HUMAN | 1.98 | -0.73 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
