rs10870351 chr10:132904619 A>G
- Sequence
gcacggccagggcgcccagccccc[A/G]catcctcctgttgtgtgccgctct
- ASB in cell types
- foreskin keratinocyte GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -5.01 | 1.60 | 2.67 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.42 | -1.17 | 1.00 |
Items per page:
1 – 2 of 2