rs10870659 chr13:32381972 G>A
- Sequence
aaggaaagactgcaagaaaagcaa[G/A]tatgtggggaagttcaggagctca
- ASB in cell types
- foreskin keratinocyte liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.94 | 1.45 | 1.00 | |||
| liver | 2.17 | -1.74 | 1.00 |
Items per page:
1 – 2 of 2