rs10871337 chr16:77438103 T>C
- Sequence
gcccatgctccagtcttggagtta[T/C]aaactgcaaagtagcttttaagtt
- ASB in cell types
- WA01 (H1, human embryonic stem cells) Peyer's patch GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 2.35 | -1.64 | 1.00 | |||
| Peyer's patch | -2.52 | 2.62 | 1.00 | |||
| GM23338 | -1.26 | 1.69 | 1.00 |
Items per page:
1 – 3 of 3