rs10873298 chr14:76960182 C>T
- Sequence
ccaaatatgaacagataggaacct[C/T]gtgatcttttggggctgtcatcct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN ZN687_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.07 | -1.55 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | 1.88 | -1.85 | 1.25 | n/a | n/a | |||
| ZN687_HUMAN | 2.89 | -2.77 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, ldl cholesterol, panic disorder, premature ovarian failure, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Prostate, Uterus, Vagina