rs110337 chr6:89035499 G>A
- Sequence
tggagcatcctgggaggagaagca[G/A]agcaacaggactggcacgtgatat
- ASB in cell types
- sigmoid colon monocytes from periferal blood A549 (lung carcinoma) gastroesophageal sphincter
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 3.07 | -0.09 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, total cholesterol change with statins, years of education