rs11072325 chr15:71744269 A>G
- Sequence
tgaaagtaaaacaaaaaacctaaa[A/G]cagttataaacattcattcaacac
- ASB in cell types
- foreskin keratinocyte heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -3.04 | 0.87 | 2.17 | |||
| heart left ventricle | -1.90 | 2.29 | 1.00 |
Items per page:
1 – 2 of 2