rs11107007 chr12:93388001 T>C
- Sequence
gtggccttgccctcatttgaacac[T/C]caaatgaactattcaagatgagta
- ASB in cell types
- CAR-T cells
- ASB for transcription factors
- TCF21_HUMAN IRF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.19 | n/a | 2.00 | n/a | No Hit | |||
| IRF4_HUMAN | 2.21 | -1.89 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP irritible bowel syndrome, primary rhegmatogenous retinal detachment, prop taste detection threshold, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid