rs11107406 chr12:94102396 A>T
- Sequence
gaaacggctttcgaagcatccgcg[A/T]ttctctttattgaatcttgagtga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte THP-1 (acute monocytic leukemia) MDA-MB-231 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.37 | 0.10 | 2.49 | |||
| foreskin keratinocyte | 0.56 | n/a | 2.67 | |||
| THP-1 (acute monocytic leukemia) | 0.79 | 0.87 | 1.00 | |||
| MDA-MB-231 (breast adenocarcinoma) | 0.76 | 1.09 | 1.03 |
Items per page:
1 – 4 of 4