rs11107417 chr12:94142055 C>G
- Sequence
taggtttccttgagtataaaggaa[C/G]caaaaacatccaagttatctcttc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 2.14 | -1.85 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -2.24 | 2.15 | 1.00 |
Items per page:
1 – 2 of 2