rs11107464 chr12:94230623 G>A
- Sequence
tggagtgttatttgtcacaggagg[G/A]atttctcgtgctctgtcaaacact
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.59 | 0.89 | 1.09 |
Items per page:
1 – 1 of 1