rs11108301 chr12:95849282 A>G
- Sequence
aagtgtttaaagtcagtattgaac[A/G]ctgatcatctacttgagtggtttc
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) HeLa Kyoto (cervical adenocarcinoma) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 1.55 | 0.35 | 1.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.60 | 1.74 | 2.00 | |||
| Peyer's patch | 1.74 | -1.44 | 1.00 |
Items per page:
1 – 3 of 3