rs11109604 chr12:98783591 T>C
- Sequence
cattcaaaagacaatgacggccta[T/C]taggggtgattgagctgactcttg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.12 | 1.41 | 2.07 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, cystatin c in serum, fasting insulin, hip bone mineral density (bmd), longstanding arthritis, microalbuminuria, schizophrenia, spine bone mineral density (bmd), treatment outcomes for selective serotonin reuptake inhibitors (ssris) - remission at 8 weeks