rs11110153 chr12:99959760 C>T
- Sequence
ttagtcatagttgacactgaacag[C/T]gtccaaattcaaggaaggagttaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.13 | 1.14 | 2.45 | |||
| breast tumor | -0.41 | 1.71 | 2.00 |
Items per page:
1 – 2 of 2