rs11110925 chr12:101653694 A>G
- Sequence
cattatgtgaagatcaaacggaag[A/G]catttccatacggaggcaattaca
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- MIXL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MIXL1_HUMAN | -2.33 | 2.58 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Pancreas, Spleen, Testis, Thyroid