rs11111979 chr12:104287004 C>G
- Sequence
tggcttctcgtagccattaggaaa[C/G]agcaaccctttcacctcagttttc
- ASB in cell types
- HEK293 (embryonic kidney) primary B-CLL cells CD14+ monocytes TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- FEZF1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FEZF1_HUMAN | n/a | 2.72 | 2.00 | 5.02 | Concordant | |||
| STAT1_HUMAN | 1.36 | -0.23 | 1.67 | -0.35 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
