rs11112507 chr12:105383660 C>G
- Sequence
gattcagcagtgtcttcataatag[C/G]aggaagtttatgttctggctttgc
- ASB in cell types
- H929 (plasma cell myeloma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -2.24 | 2.64 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.71 | 0.52 | 1.03 |
Items per page:
1 – 2 of 2