rs11113431 chr12:107671175 G>A
- Sequence
atcggtaaatagctctgatgttga[G/A]acagcaggaggtcaggacattgag
- ASB in cell types
- HepG2 (hepatoblastoma) right lobe of liver SUM159PT (Triple negative breast cancer) MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
- ASB for transcription factors
- CEBPA_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | -0.53 | 2.39 | 1.50 | 2.17 | Concordant | |||
| FOXP1_HUMAN | -2.29 | 2.61 | 1.25 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
