rs11113566 chr12:107885150 T>A
- Sequence
ctgatctattgtgatctgaaatca[T/A]cctttgtatgatttatattctttt
- ASB in cell types
- H929 (plasma cell myeloma) foreskin keratinocyte GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -2.13 | 2.44 | 1.00 | |||
| foreskin keratinocyte | n/a | 0.79 | 2.17 | |||
| GBM39 (Human brain tumor) | 1.31 | 0.08 | 1.00 |
Items per page:
1 – 3 of 3