rs11117620 chr1:216562484 G>T
- Sequence
ggttagaacagtggttttcagttt[G/T]ggggaagagggtcaggctggggcg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.59 | -1.31 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.62 | 1.75 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.45 | 1.66 | 1.00 |
Items per page:
1 – 3 of 3