rs11119860 chr1:212158952 T>C
- Sequence
atcctaccctagttctctgccaga[T/C]ggcacactgctatctacttatcaa
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.98 | -0.38 | 1.17 | -1.85 | Weak Concordant | |||
| STAG1_HUMAN | 2.57 | -0.57 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP obesity with early age of onset (age >2), suicide attempts in bipolar disorder (females), triglycerides