rs111206807 chr14:94519711 G>A
- Sequence
gatggagatgatggtggtgatgga[G/A]atggtggtggtgatggtgatgata
- ASB in cell types
- HEK293 (embryonic kidney) cardiac progenitor stage cells differentiated from H7
- ASB for transcription factors
- SETD7_HUMAN ZN157_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SETD7_HUMAN | -1.72 | 2.12 | 1.17 | n/a | n/a | |||
| ZN157_HUMAN | n/a | 2.94 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2