rs11121063 chr1:7961483 T>C
- Sequence
cacggagggtggcggtagagactg[T/C]taagccccgcgggcgccggggcag
- ASB in cell types
- erythroid progenitors GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.20 | -4.66 | 2.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.77 | 1.01 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood