rs11122174 chr1:230978849 C>T
- Sequence
tgccatcttccctcaaggcgcatg[C/T]gcgacagcccttgcccggctctca
- ASB in cell types
- K562 (myelogenous leukemia) keratinocytes HEK293T (embryonic kidney) HEK293 (embryonic kidney)
- ASB for transcription factors
- SNAI2_HUMAN JUN_HUMAN TYY1_HUMAN MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.52 | -0.79 | 2.50 | n/a | No Hit | |||
| JUN_HUMAN | -0.14 | 1.52 | 1.88 | n/a | No Hit | |||
| TYY1_HUMAN | -0.04 | 1.72 | 2.50 | n/a | No Hit | |||
| MAX_HUMAN | -0.61 | 1.47 | 1.19 | 3.45 | Concordant | |||
| ZFX_HUMAN | -0.03 | 0.93 | 1.67 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood