rs11122453 chr1:230167865 C>A
- Sequence
ctgagggcttcacctctctcctcc[C/A]acctttttttcttacctattggca
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) LNCaP (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | -1.48 | 1.60 | 1.00 | |||
| LNCaP (prostate carcinoma) | -1.19 | 1.49 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.91 | 0.27 | 1.12 |
Items per page:
1 – 3 of 3