rs11123532 chr2:119703189 G>A
- Sequence
ttatccctcagccctcagccctgg[G/A]cccagccctgcattttcctctaga
- ASB in cell types
- A549 (lung carcinoma) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.10 | 1.10 | 2.03 | |||
| GM02630 (Fanconi anemi) | 0.70 | -0.26 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Liver, Nerve_Tibial, Spleen, Whole_Blood