rs11123741 chr2:109325098 A>G
- Sequence
agaagggaggatgccatggctctg[A/G]caaggcccaagaggtcagggaggg
- ASB in cell types
- liver upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.96 | -0.51 | 1.00 | |||
| upper lobe of left lung | 2.74 | 0.23 | 1.50 |
Items per page:
1 – 2 of 2