rs11124625 chr2:37907808 A>T
- Sequence
gcgttttacgttttggaatccaga[A/T]aattacccaattaattagctagat
- ASB in cell types
- iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived dermal fibroblasts | -2.45 | 2.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting insulin, homa-ir, ldl cholesterol change with statins, microalbuminuria, total cholesterol change with statins, urinary albumin-to-creatinine ratio