rs11126078 chr2:66429270 T>C
- Sequence
aaggctgctgtggtttgaagtgta[T/C]gtgtgtgatcttctttaaaatagc
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma) EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.09 | 0.82 | 2.00 | |||
| A549 (lung carcinoma) | 0.93 | 0.55 | 1.05 | |||
| EOL-1 (Acute myeloid leukemia) | 1.78 | -1.49 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Minor_Salivary_Gland, Prostate, Stomach, Uterus