rs11127133 chr2:28135612 T>C
- Sequence
tgtgttcagttgacacctcaaatt[T/C]aaagggcctgaaactaaactcatc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -2.11 | 2.53 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, homa-b, irritible bowel syndrome, salmonella-induced pyroptosis, serum creatinine, tardive dyskinesia, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood