rs11127204 chr2:29147017 G>C
- Sequence
tttttgtttgtttataaaaatgct[G/C]attgtataagatttgaaaacaaga
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, mitral annular calcium, parkinsons disease, total cholesterol change with statins