rs11128623 chr3:12898330 T>C
- Sequence
aacaatgtatcttccacaaacttt[T/C]gataagcttgcaaataaaacagaa
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.61 | -4.84 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, major depressive disorder (citalopram treatment remission), major depressive disorder (citalopram treatment response), major depressive disorder (citalopram treatment tolerance), salmonella-induced pyroptosis, systolic blood pressure (sbp), years of education